Remarks:
Result file description: The node in the figure represents a sample or a group of samples(Samples in the group only display one name as a representative, and other hidden names are listed in the file id_rep.txt),The number on the line between the nodes represents the distance.
Upload file description: SNP FASTA file or genotype (profile allele) file.
(1)SNP FASTA files need to aligned, all sample sequences are the same length,download the file snp.fasto test,E.g :
>sample_1 TCGAGGAACCGCTCGAGCCCATCGAGTTCGGCCGTATCGGCGCCCAGGCCGCCAAGCAGG ........... >sample_2 TCGAGGAACCGCTCGAGCCCATCGAGTTCGGTCGTATCGGCGCCCAGGCCGCCAAGCAGG ........... >sample_3 TCGAGGAACCGCTCGAGCCCATCGAGTTCGGTCGTATCGGCGCCCAGGCCGCCAAGCAGG ...........
(2) SNP profile allele file format , E.g:
ID SNP1 SNP2 SNP3 SNP4 SNP5 SNP6 SNP7 SNP8 SNP9 ... Sample1 0 1 1 0 0 1 0 0 0 ... Sample2 1 1 1 0 0 1 0 1 1 ... Sample3 1 1 0 1 0 0 0 0 1 ... Sample4 0 0 0 1 0 0 0 0 1 ... Sample5 1 0 0 1 1 1 0 0 1 ... Sample6 1 1 0 0 1 0 0 1 1 ... Sample7 0 1 0 1 0 0 1 1 0 ... Sample8 1 0 1 1 0 0 0 0 0 ... Sample9 0 0 0 0 1 0 0 0 1 ... ...
(3) MLST profile allele file format,E.g :
sample abcZ bglA cat dapE dat ldh lhkA sample1 1 1 1 10 1 3 5 sample2 1 1 1 10 1 3 5 sample3 1 1 1 10 1 3 5 sample4 1 1 1 10 1 3 5 sample5 1 1 2 1 1 1 1 sample6 1 1 1 10 1 3 5 sample7 1 1 1 10 1 3 5 sample8 1 1 1 10 1 3 5 sample9 4 1 6 1 1 10 1 ...