Probiotic Evaluation Report
Key Laboratory of microorganism technology and bioinformatics research of Zhejiang Province
1 Summary
- The species of your sequence files is Lactobacillus rhamnosus
- ANI vs type genome of Lactobacillus rhamnosus is : 99.8407
- Gene annotation
- Genome Structure
| Gene_num | 2934 |
| Gene_total_length(bp) | 2,602,163 |
| Gene_average_length(bp) | 886.90 |
| GC_content_in_gene_region(%) | 47.36 |
| Gene/Genome(%) | 85.79 |
| Intergenetic_region_length(bp) | 430,943 |
| GC_content_in_intergenetic_region(%) | 42.57 |
| Intergenetic/Genome(%) | 14.21 |
| contain Plasmids | YES |
| contain Genomic islands | YES |
| contain Transposons | NO |
| contain Prophage | YES |
| contain CRISPR/Cas | YES |
2 Safety assessment
2.1 Pathogenicity
Virulence factors, including such as exotoxin, endotoxin, cytolysin and hemolysin secreted by bacteria may contribute to the pathogenicity of the bacterium, which can cause major damage to the hosts by destroying cells or disrupting metabolism in hosts.
NO result found.
2.2 Toxic metabolites
Certain enzymes in bacteria can convert substrates to toxic metabolites. D-Lactate dehydrogenase, decarboxylase, nitroreductase and nitrate reductase, andβ-glucuronidase can respectively catalyze the formation of D-lactate, biogenic amines, nitrocompounds and aglycones, which are toxic to hosts.
| Location in Genome | Gene | Class | Annot | Is in Plasmids | Is in Genomic islands |
| FM179323.1|43176..44987 | tr|A0A249N673|A0A249N673_LACRH | Aglycones | Beta-glucuronidase | NO | NO |
| FM179323.1|169223..170224 | sp|Q88VJ2|LDHD_LACPL | D-lactate | D-lactate dehydrogenase | NO | NO |
| FM179323.1|224622..225209 | sp|P26297|LDHD_LACDA | D-lactate | D-lactate dehydrogenase | NO | NO |
| FM179323.1|400111..401109 | sp|P30901|LDHD_LACHE | D-lactate | D-lactate dehydrogenase | NO | NO |
| FM179323.1|477507..478190 | tr|A0A3S4TBI4|A0A3S4TBI4_LACRH | Nitrocompounds | Nitroreductase family protein | NO | NO |
| FM179323.1|690627..691286 | tr|A0A2Y8ZKH4|A0A2Y8ZKH4_LACRH | Nitrocompounds | Nitroreductase family protein | NO | NO |
| FM179323.1|744332..745486 | tr|A0A0R2MFT7|A0A0R2MFT7_9LACO | Nitrocompounds | Periplasmic nitrate reductase NapA | NO | NO |
| FM179323.1|1048196..1049068 | tr|A0A0C9QD00|A0A0C9QD00_LACPA | Aglycones | Phospho-beta-glycosidase | NO | NO |
| FM179323.1|1452417..1453052 | tr|A0A1F0RWM3|A0A1F0RWM3_9LACO | Nitrocompounds | Nitroreductase | NO | NO |
| FM179323.1|1485572..1486174 | tr|A0A1F0RS70|A0A1F0RS70_9LACO | Nitrocompounds | Nitroreductase | NO | NO |
| FM179323.1|1932414..1933169 | tr|A0A2Y8ZKC8|A0A2Y8ZKC8_LACRH | Nitrocompounds | NADPH-dependent oxidoreductase | NO | NO |
| FM179323.1|1987394..1989223 | tr|I7LAW5|I7LAW5_9LACO | Nitrocompounds | Periplasmic nitrate reductase NapA | NO | NO |
| FM179323.1|2199725..2200717 | sp|Q88VJ2|LDHD_LACPL | D-lactate | D-lactate dehydrogenase | NO | NO |
| FM179323.1|2911888..2912865 | sp|Q88VJ2|LDHD_LACPL | D-lactate | D-lactate dehydrogenase | NO | NO |
| FM179324.1|10622..11071 | tr|A0A179XGH0|A0A179XGH0_LACRH | Nitrocompounds | Nitroreductase | Yes | NO |
2.3 Antibiotic Resistance
Antibiotic resistance in the mobile elements or plamids of probiotic strain may transfer into other microbial species, for example, enterobactria.
| Location in Genome | Subject_id | %Identity | E-value | Score | Name | AMR Gene Family | Drug Class | Resistance Mechanism | Model Type | Description | Is in Plasmids | Is in Genomic islands |
| FM179323.1|243079..243765 | gb|AAR84672.1|ARO:3002925|vanRF | 49 | 2e-58 | 218 | vanRF | glycopeptide resistance gene cluster;vanR | glycopeptide antibiotic | antibiotic target alteration | homolog_model | vanRF is a vanR variant found in the vanF gene cluster | NO | NO |
| FM179323.1|582949..584190 | gb|WP_125169584.1|ARO:3000024|patA | 53 | 1e-129 | 453 | patA | ATP-binding cassette (ABC) antibiotic efflux pump | fluoroquinolone antibiotic | antibiotic efflux | homolog_model | PatA is an ABC transporter of Streptococcus pneumoniae that interacts with PatB to confer fluoroquinolone resistance. | NO | NO |
| FM179323.1|584194..585975 | gb|ABF66027.1|ARO:3002882|lmrD | 53 | 1e-169 | 587 | lmrD | ATP-binding cassette (ABC) antibiotic efflux pump | lincosamide antibiotic | antibiotic efflux | homolog_model | lmrD is a chromosomally-encoded efflux pump that confers resistance to lincosamides in Streptomyces lincolnensis and Lactococcus lactis. It can dimerize with lmrC | NO | NO |
| FM179323.1|601581..603065 | gb|AAT46077.1|ARO:3000300|lsaA | 48 | 1e-135 | 474 | lsaA | ABC-F ATP-binding cassette ribosomal protection protein | lincosamide antibiotic;streptogramin antibiotic;pleuromutilin antibiotic | antibiotic target protection | homolog_model | LsaA is an ABC-F subfamily protein expressed in Enterococcus faecalis. It confers resistance to clindamycin, quinupristin-dalfopristin, and dalfopristin. | NO | NO |
| FM179323.1|962734..963399 | gb|AAV85982.1|ARO:3000535|macB | 42 | 2e-44 | 171 | macB | ATP-binding cassette (ABC) antibiotic efflux pump | macrolide antibiotic | antibiotic efflux | homolog_model | MacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC. macB corresponds to 1 locus in Pseudomonas aeruginosa PAO1 and 1 locus in Pseudomonas aeruginosa LESB58. | NO | NO |
| FM179323.1|1170379..1172109 | gb|CDO61513.1|ARO:3003948|efrA | 41 | 1e-107 | 383 | efrA | ATP-binding cassette (ABC) antibiotic efflux pump | macrolide antibiotic;fluoroquinolone antibiotic;rifamycin antibiotic | antibiotic efflux | homolog_model | efrA is a part of the EfrAB efflux pump, and both efrA and efrB are necessary to confer drug resistance. | NO | NO |
| FM179323.1|1405631..1407544 | gb|APB03219.1|ARO:3003986|TaeA | 48 | 1e-149 | 522 | TaeA | ATP-binding cassette (ABC) antibiotic efflux pump | pleuromutilin antibiotic | antibiotic efflux | homolog_model | Pleuromutilin (Tiamulin) ABC efflux pump found in Paenibacillus sp. LC231, a strain of Paenibacillus isolated from Lechuguilla Cave, NM, USA. Confers resistance to pleuromutilin antibiotics. Described by Pawlowski et al. 2016. | NO | NO |
| FM179323.1|1725401..1726087 | gb|WP_000192137.1|ARO:3000838|arlR | 48 | 5e-57 | 213 | arlR | major facilitator superfamily (MFS) antibiotic efflux pump | fluoroquinolone antibiotic;acridine dye | antibiotic efflux | homolog_model | ArlR is a response regulator that binds to the norA promoter to activate expression. ArlR must first be phosphorylated by ArlS. | NO | NO |
| FM179323.1|1944845..1945549 | gb|AAV85982.1|ARO:3000535|macB | 43 | 4e-40 | 157 | macB | ATP-binding cassette (ABC) antibiotic efflux pump | macrolide antibiotic | antibiotic efflux | homolog_model | MacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC. macB corresponds to 1 locus in Pseudomonas aeruginosa PAO1 and 1 locus in Pseudomonas aeruginosa LESB58. | NO | NO |
| FM179323.1|2290727..2291323 | gb|NP_465220.1|ARO:3003770|Listeria | 63 | 9e-62 | 228 | Listeria monocytogenes mprF | defensin resistant mprF | peptide antibiotic | antibiotic target alteration | homolog_model | MprF is a integral membrane protein that modifies the negatively-charged phosphatidylglycerol on the membrane surface. This confers resistance to cationic peptides that disrupt the cell membrane, including defensins. | NO | NO |
| FM179323.1|2291355..2293337 | gb|NP_465220.1|ARO:3003770|Listeria | 40 | 1e-144 | 505 | Listeria monocytogenes mprF | defensin resistant mprF | peptide antibiotic | antibiotic target alteration | homolog_model | MprF is a integral membrane protein that modifies the negatively-charged phosphatidylglycerol on the membrane surface. This confers resistance to cationic peptides that disrupt the cell membrane, including defensins. | NO | NO |
| FM179323.1|2305859..2307091 | gb|ABV18113.1|ARO:3001329|mdtG | 44 | 8e-89 | 320 | mdtG | major facilitator superfamily (MFS) antibiotic efflux pump | fosfomycin | antibiotic efflux | homolog_model | The MdtG protein, also named YceE, appears to be a member of the major facilitator superfamily of transporters, and it has been reported, when overexpressed, to increase fosfomycin and deoxycholate resistances. mdtG is a member of the marA-soxS-rob regulon. | NO | YES |
| FM179323.1|2409726..2410394 | gb|AAV85982.1|ARO:3000535|macB | 42 | 2e-44 | 171 | macB | ATP-binding cassette (ABC) antibiotic efflux pump | macrolide antibiotic | antibiotic efflux | homolog_model | MacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC. macB corresponds to 1 locus in Pseudomonas aeruginosa PAO1 and 1 locus in Pseudomonas aeruginosa LESB58. | NO | NO |
| FM179323.1|2849725..2850438 | gb|ACL82957.1|ARO:3002928|vanRM | 44 | 2e-51 | 194 | vanRM | glycopeptide resistance gene cluster;vanR | glycopeptide antibiotic | antibiotic target alteration | homolog_model | vanRM is a vanR variant found in the vanM gene cluster | NO | NO |
| FM179323.1|2933270..2933959 | gb|AAV85982.1|ARO:3000535|macB | 45 | 1e-55 | 208 | macB | ATP-binding cassette (ABC) antibiotic efflux pump | macrolide antibiotic | antibiotic efflux | homolog_model | MacB is an ATP-binding cassette (ABC) transporter that exports macrolides with 14- or 15- membered lactones. It forms an antibiotic efflux complex with MacA and TolC. macB corresponds to 1 locus in Pseudomonas aeruginosa PAO1 and 1 locus in Pseudomonas aeruginosa LESB58. | NO | NO |
| Location in Genome | Subject_id | %Identity | E-value | Score | Name | AMR Gene Family | Drug Class | Resistance Mechanism | Model Type | Mutations | Description | Is in Plasmids | Is in Genomic islands |
| FM179323.1|928210..928803 | gb|WP_001025093|ARO:3003323|Staphylococcus | 46 | 8e-40 | 155 | Staphylococcus aureus pgsA mutations conferring resistance to daptomycin | daptomycin resistant pgsA | peptide antibiotic | antibiotic target alteration | variant_model | K66R | Point mutations that occur within Staphylococcus aureus pgsA gene resulting in resistance to daptomycin | NO | NO |
| FM179323.1|1407745..1408512 | gb|NP_217280.1|ARO:3004153|Mycobacterium | 47 | 5e-62 | 230 | Mycobacterium tuberculosis thyA with mutation conferring resistance to para-aminosalicylic acid | aminosalicylate resistant thymidylate synthase | para-aminosalicylic acid | antibiotic target alteration | variant_model | W98STOP;W83STOP;G76STOP | Point mutations in the thymidylate synthetase thyA gene shown clinically to confer resistance to para-aminosalicylic acid. Loss-of-function mutations in thyA disrupt the catalytic activity and substrate-binding affinity, thus conferring resistance. | NO | NO |
| FM179323.1|1486464..1487933 | gb|AEA93051.1|ARO:3003760|Enterococcus | 48 | 1e-122 | 431 | Enterococcus faecalis cls with mutation conferring resistance to daptomycin | daptomycin resistant cls | peptide antibiotic | antibiotic target alteration | variant_model | H215R | cls or cardiolipin synthase is an inner membrane protein involved in membrane synthesis and phosopholipid metabolism, with mutations to the gene being capable of conferring daptomycin resistance. | NO | NO |
| FM179323.1|2517390..2519492 | gb|CAG39573|ARO:3003735|Staphylococcus | 71 | 0.0 | 1000 | Staphylococcus aureus fusA with mutation conferring resistance to fusidic acid | antibiotic resistant fusA | fusidic acid | antibiotic target alteration | variant_model | V90I | The mutations to this gene are involved in altering the translation elongation factor G (EF-G) in association with the ribosome to prevent fusidic acid from binding EF-G and preventing translation. | NO | NO |
| FM179323.1|2590647..2591906 | gb|CAG41169.1|ARO:3003776|Staphylococcus | 45 | 1e-91 | 329 | Staphylococcus aureus murA with mutation conferring resistance to fosfomycin | murA transferase | fosfomycin | antibiotic target alteration | variant_model | L42STOP | murA or UDP-N-acetylglucosamine enolpyruvyl transferase catalyses the initial step in peptidoglycan biosynthesis and is inhibited by fosfomycin. Overexpression of murA through mutations confers fosfomycin resistance. | NO | NO |
3 Probiotic Determinants
Probiotic can confer health effect to hosts via a number of mechanisms.
3.1 Antibacterial activity
Bacteriocins are proteinaceous or peptidic toxins produced by a variety of bacteria to inhibit the growth of similar or closely related bacterial strain(s), which can inhibit pathogens.
3.2 Amico acid and vitamin metabolism
Probiotic bacteria play an important role in the production of uncommon amino acids and vitamins needed by hosts.
| KEGG pathway ID | Metabolism of vitamins | Gene Number | Gene list |
| 00250 | Alanine, aspartate and glutamate metabolism | 19 | L.rhamnosus.Lc-705.genome_00131;L.rhamnosus.Lc-705.genome_00245;L.rhamnosus.Lc-705.genome_00515;L.rhamnosus.Lc-705.genome_00572;L.rhamnosus.Lc-705.genome_01037;L.rhamnosus.Lc-705.genome_01148;L.rhamnosus.Lc-705.genome_01468;L.rhamnosus.Lc-705.genome_01469;L.rhamnosus.Lc-705.genome_01471;L.rhamnosus.Lc-705.genome_01669;L.rhamnosus.Lc-705.genome_01777;L.rhamnosus.Lc-705.genome_02145;L.rhamnosus.Lc-705.genome_02213;L.rhamnosus.Lc-705.genome_02246;L.rhamnosus.Lc-705.genome_02492;L.rhamnosus.Lc-705.genome_02493;L.rhamnosus.Lc-705.genome_02755;L.rhamnosus.Lc-705.genome_02756;L.rhamnosus.Lc-705.genome_02807 |
| 00260 | Glycine, serine and threonine metabolism | 26 | L.rhamnosus.Lc-705.genome_00087;L.rhamnosus.Lc-705.genome_00088;L.rhamnosus.Lc-705.genome_00106;L.rhamnosus.Lc-705.genome_00108;L.rhamnosus.Lc-705.genome_00386;L.rhamnosus.Lc-705.genome_01177;L.rhamnosus.Lc-705.genome_01178;L.rhamnosus.Lc-705.genome_01191;L.rhamnosus.Lc-705.genome_01209;L.rhamnosus.Lc-705.genome_01231;L.rhamnosus.Lc-705.genome_01232;L.rhamnosus.Lc-705.genome_01233;L.rhamnosus.Lc-705.genome_01319;L.rhamnosus.Lc-705.genome_01334;L.rhamnosus.Lc-705.genome_01922;L.rhamnosus.Lc-705.genome_01955;L.rhamnosus.Lc-705.genome_02036;L.rhamnosus.Lc-705.genome_02117;L.rhamnosus.Lc-705.genome_02131;L.rhamnosus.Lc-705.genome_02132;L.rhamnosus.Lc-705.genome_02133;L.rhamnosus.Lc-705.genome_02134;L.rhamnosus.Lc-705.genome_02310;L.rhamnosus.Lc-705.genome_02589;L.rhamnosus.Lc-705.genome_02815;L.rhamnosus.Lc-705.genome_02916 |
| 00270 | Cysteine and methionine metabolism | 27 | L.rhamnosus.Lc-705.genome_00066;L.rhamnosus.Lc-705.genome_00106;L.rhamnosus.Lc-705.genome_00108;L.rhamnosus.Lc-705.genome_00324;L.rhamnosus.Lc-705.genome_00449;L.rhamnosus.Lc-705.genome_00535;L.rhamnosus.Lc-705.genome_00536;L.rhamnosus.Lc-705.genome_00540;L.rhamnosus.Lc-705.genome_00560;L.rhamnosus.Lc-705.genome_00571;L.rhamnosus.Lc-705.genome_00729;L.rhamnosus.Lc-705.genome_00894;L.rhamnosus.Lc-705.genome_00909;L.rhamnosus.Lc-705.genome_01228;L.rhamnosus.Lc-705.genome_01231;L.rhamnosus.Lc-705.genome_01232;L.rhamnosus.Lc-705.genome_01265;L.rhamnosus.Lc-705.genome_01314;L.rhamnosus.Lc-705.genome_02008;L.rhamnosus.Lc-705.genome_02133;L.rhamnosus.Lc-705.genome_02134;L.rhamnosus.Lc-705.genome_02485;L.rhamnosus.Lc-705.genome_02549;L.rhamnosus.Lc-705.genome_02844;L.rhamnosus.Lc-705.genome_02901;L.rhamnosus.Lc-705.genome_02902;L.rhamnosus.Lc-705.genome_02903 |
| 00290 | Valine, leucine and isoleucine biosynthesis | 2 | L.rhamnosus.Lc-705.genome_01868;L.rhamnosus.Lc-705.genome_02008 |
| 00300 | Lysine biosynthesis | 18 | L.rhamnosus.Lc-705.genome_00101;L.rhamnosus.Lc-705.genome_00102;L.rhamnosus.Lc-705.genome_00103;L.rhamnosus.Lc-705.genome_00104;L.rhamnosus.Lc-705.genome_00105;L.rhamnosus.Lc-705.genome_00106;L.rhamnosus.Lc-705.genome_00107;L.rhamnosus.Lc-705.genome_00108;L.rhamnosus.Lc-705.genome_00244;L.rhamnosus.Lc-705.genome_00455;L.rhamnosus.Lc-705.genome_00824;L.rhamnosus.Lc-705.genome_01185;L.rhamnosus.Lc-705.genome_01210;L.rhamnosus.Lc-705.genome_01814;L.rhamnosus.Lc-705.genome_02133;L.rhamnosus.Lc-705.genome_02134;L.rhamnosus.Lc-705.genome_02139;L.rhamnosus.Lc-705.genome_02501 |
| 00220 | Arginine biosynthesis | 5 | L.rhamnosus.Lc-705.genome_00515;L.rhamnosus.Lc-705.genome_00572;L.rhamnosus.Lc-705.genome_01669;L.rhamnosus.Lc-705.genome_02755;L.rhamnosus.Lc-705.genome_02756 |
| 00330 | Arginine and proline metabolism | 9 | L.rhamnosus.Lc-705.genome_00715;L.rhamnosus.Lc-705.genome_01671;L.rhamnosus.Lc-705.genome_01672;L.rhamnosus.Lc-705.genome_01831;L.rhamnosus.Lc-705.genome_01951;L.rhamnosus.Lc-705.genome_02251;L.rhamnosus.Lc-705.genome_02324;L.rhamnosus.Lc-705.genome_02325;L.rhamnosus.Lc-705.genome_02546 |
| 00340 | Histidine metabolism | 13 | L.rhamnosus.Lc-705.genome_01238;L.rhamnosus.Lc-705.genome_01448;L.rhamnosus.Lc-705.genome_01449;L.rhamnosus.Lc-705.genome_01450;L.rhamnosus.Lc-705.genome_01451;L.rhamnosus.Lc-705.genome_01452;L.rhamnosus.Lc-705.genome_01453;L.rhamnosus.Lc-705.genome_01454;L.rhamnosus.Lc-705.genome_01455;L.rhamnosus.Lc-705.genome_01456;L.rhamnosus.Lc-705.genome_01457;L.rhamnosus.Lc-705.genome_01458;L.rhamnosus.Lc-705.genome_01570 |
| 00350 | Tyrosine metabolism | 5 | L.rhamnosus.Lc-705.genome_00736;L.rhamnosus.Lc-705.genome_01448;L.rhamnosus.Lc-705.genome_01458;L.rhamnosus.Lc-705.genome_02246;L.rhamnosus.Lc-705.genome_02625 |
| 00360 | Phenylalanine metabolism | 4 | L.rhamnosus.Lc-705.genome_01448;L.rhamnosus.Lc-705.genome_01458;L.rhamnosus.Lc-705.genome_02251;L.rhamnosus.Lc-705.genome_02625 |
| 00380 | Tryptophan metabolism | 2 | L.rhamnosus.Lc-705.genome_01809;L.rhamnosus.Lc-705.genome_02251 |
| 00400 | Phenylalanine, tyrosine and tryptophan biosynthesis | 8 | L.rhamnosus.Lc-705.genome_00087;L.rhamnosus.Lc-705.genome_00088;L.rhamnosus.Lc-705.genome_00089;L.rhamnosus.Lc-705.genome_00090;L.rhamnosus.Lc-705.genome_00091;L.rhamnosus.Lc-705.genome_01081;L.rhamnosus.Lc-705.genome_01448;L.rhamnosus.Lc-705.genome_01458 |
| KEGG pathway ID | Metabolism of vitamins | Gene Number | Gene list |
| 00730 | Thiamine metabolism | 10 | L.rhamnosus.Lc-705.genome_00341;L.rhamnosus.Lc-705.genome_00343;L.rhamnosus.Lc-705.genome_00344;L.rhamnosus.Lc-705.genome_00345;L.rhamnosus.Lc-705.genome_00346;L.rhamnosus.Lc-705.genome_00638;L.rhamnosus.Lc-705.genome_01272;L.rhamnosus.Lc-705.genome_01273;L.rhamnosus.Lc-705.genome_01315;L.rhamnosus.Lc-705.genome_01635 |
| 00740 | Riboflavin metabolism | 1 | L.rhamnosus.Lc-705.genome_01584 |
| 00750 | Vitamin B6 metabolism | 2 | L.rhamnosus.Lc-705.genome_00558;L.rhamnosus.Lc-705.genome_02132 |
| 00760 | Nicotinate and nicotinamide metabolism | 9 | L.rhamnosus.Lc-705.genome_00297;L.rhamnosus.Lc-705.genome_00590;L.rhamnosus.Lc-705.genome_00917;L.rhamnosus.Lc-705.genome_00937;L.rhamnosus.Lc-705.genome_01704;L.rhamnosus.Lc-705.genome_01826;L.rhamnosus.Lc-705.genome_01828;L.rhamnosus.Lc-705.genome_02246;L.rhamnosus.Lc-705.genome_02702 |
| 00770 | Pantothenate and CoA biosynthesis | 7 | L.rhamnosus.Lc-705.genome_01343;L.rhamnosus.Lc-705.genome_01643;L.rhamnosus.Lc-705.genome_01725;L.rhamnosus.Lc-705.genome_01868;L.rhamnosus.Lc-705.genome_01943;L.rhamnosus.Lc-705.genome_02008;L.rhamnosus.Lc-705.genome_02499 |
| 00780 | Biotin metabolism | 8 | L.rhamnosus.Lc-705.genome_00385;L.rhamnosus.Lc-705.genome_00775;L.rhamnosus.Lc-705.genome_00934;L.rhamnosus.Lc-705.genome_02033;L.rhamnosus.Lc-705.genome_02086;L.rhamnosus.Lc-705.genome_02088;L.rhamnosus.Lc-705.genome_02089;L.rhamnosus.Lc-705.genome_02095 |
| 00790 | Folate biosynthesis | 2 | L.rhamnosus.Lc-705.genome_01276;L.rhamnosus.Lc-705.genome_01409 |
3.3 Exopolysaccharide(EPS)
Exopolysaccharides (EPs) secreted by a microorganism into the surrounding environment, are high-molecular-weight polymers, which are probiotic effector molecules and biofilm-forming ability help in colonizing the gut.
| Location in Genome | Subject_id | %Identity | E-value | Score | ProteinID | Description |
| FM179323.1|277449..278543 | epsA | 39.088 | 2.92e-64 | 199 | AAV43549.1 | Exopolysaccharide biosynthesis protein [Lactobacillus acidophilus NCFM] |
| FM179323.1|2008003..2008641 | FC33_RS02555 | 33.503 | 3.37e-39 | 127 | KRM39412.1 | tyrosine-protein kinase [Lactobacillus aviarius subsp. aviarius DSM 20655] |
| FM179323.1|2061488..2062165 | epsD | 56.889 | 3.15e-103 | 290 | AAV43546.1 | Exopolysaccharide biosynthesis protein [Lactobacillus acidophilus NCFM] |
| FM179323.1|2062322..2063215 | epsA | 37.500 | 4.77e-70 | 212 | AAV43549.1 | Exopolysaccharide biosynthesis protein [Lactobacillus acidophilus NCFM] |
| FM179323.1|2077732..2078484 | LGG_RS09880 | 89.167 | 4.30e-158 | 430 | AKP20072.1 | tyrosine-protein kinase [Lactobacillus rhamnosus GG] |
| FM179323.1|2078503..2079417 | epsB | 39.015 | 8.24e-58 | 179 | AAV43548.1 | Exopolysaccharide biosynthesis protein [Lactobacillus acidophilus NCFM] |
| FM179323.1|2268560..2269618 | epsA | 44.231 | 6.35e-70 | 213 | AAV43549.1 | Exopolysaccharide biosynthesis protein [Lactobacillus acidophilus NCFM] |
| FM179324.1|36389..36946 | LRC_RS00510 | 30.693 | 5.71e-09 | 43.9 | AEN77430.1 | Exoploysaccharide biosynthesis acetyltransferase [Lactobacillus ruminis ATCC 27782] |
3.4 Antioxidative activity
Probiotics with physiologically relevant multivalent antioxidative properties/effects expressed via a positive influence both on a gastrointestinal tract, since some strains of Lactobacillus possess strong antioxidative activity by eliminating ROS.
| Query_id | Subject_id | %Identity | E-value | Score | ProteinID | Description | |
| FM179323.1|483934..485304 | tr|A0A0R1P619|A0A0R1P619_9LACO | 34.498 | 2.05e-23 | 96.7 | GR | Glutathione-disulfide reductase | OS=Lactobacillus frumenti DSM 13145 OX=1423746 GN=FD27_GL000303 PE=4 SV=1 |
| FM179323.1|900888..901361 | tr|A0A1F0RKZ1|A0A1F0RKZ1_9LACO | 100.000 | 6.06e-119 | 327 | GPx | Glutathione peroxidase | OS=Lactobacillus sp. HMSC056D05 OX=1739473 GN=HMPREF2969_08045 PE=3 SV=1 |
| FM179323.1|1327985..1329388 | tr|G0LYQ6|G0LYQ6_LACPE | 32.230 | 4.11e-63 | 206 | GR | Glutathione reductase | OS=Lactobacillus pentosus IG1 OX=1042160 GN=LPENT_00184 PE=4 SV=1 |
| FM179323.1|2651657..2652982 | tr|A0A179Y3D3|A0A179Y3D3_LACRH | 99.546 | 0.0 | 895 | GR | Glutathione reductase | OS=Lactobacillus rhamnosus OX=47715 GN=PY66_07460 PE=4 SV=1 |
| FM179324.1|46926..48275 | tr|A0A0R2MN09|A0A0R2MN09_9LACO | 31.878 | 3.53e-49 | 168 | GR | Glutathione reductase | OS=Lactobacillus saniviri JCM 17471 = DSM 24301 OX=1293598 GN=IV56_GL000180 PE=3 SV=1 |
3.5 Hypocholesterolemic effect
Enzymatic deconjugation of bile acids by Bile salt hydrolase (BSH) from probiotics has been considered to be one of the main mechanisms of the hypocholesterolemic effect attributed to probiotics.
| Location in Genome | Subject_id | %Identity | E-value | Score | Protein names | Gene names | Organism |
| FM179323.1|499651..500667 | tr|G4XR38|G4XR38_LACRH | 99.112 | 0.0 | 694 | bsh | Bile salt hydrolase | OS=Lactobacillus rhamnosus OX=47715 GN=bsh PE=4 SV=1 |
4 Survival in Gut
To reach the colon in a viable state, the probiotics should cope with many stress challenges and they should have the ability of resistance to acid and bile. Colonization of gastrointestinal (GI) tract by probiotics is essential, and the adherence and persistence capacity is also important for probiotics effect.
| Class | gene | gene_number |
| Acid resistance | LBA0995 | 3 |
| Acid resistance | LBA1524 | 1 |
| Acid resistance | LBA1272 | 1 |
| Acid resistance | gadC | -- |
| Acid resistance | rrp-1 | -- |
| Acid resistance | LBA0996 | 1 |
| Acid resistance | lr1516 | 2 |
| Acid resistance | dltD | 1 |
| Acid resistance | dltA | 1 |
| Adaptation | Lr1265 | 2 |
| Adaptation | Lr1584 | 3 |
| Adherence | lsp | -- |
| Adherence | FbpA | 1 |
| Adherence | ispA | 1 |
| Adherence | MUB | -- |
| Adherence | SlpA | -- |
| Adherence | Msa | -- |
| Adherence | MapA | 1 |
| Adherence | 32-Mmubp | 2 |
| Adherence | fpb | -- |
| Adherence | LBA1633 | -- |
| Adherence | LBA1634 | -- |
| Bile resistance | LBA1430 | -- |
| Bile resistance | clpE | 1 |
| Bile resistance | dps | -- |
| Bile resistance | LBA1429 | -- |
| Bile resistance | bsh1 | -- |
| Bile resistance | bshA | -- |
| Bile resistance | bshB | -- |
| Bile resistance | LBA1446 | 3 |
| Bile resistance | LBA1679 | 1 |
| Bile resistance | LBA1680 | 44 |
| Bile resistance | clpL | 1 |
| Bile resistance | LBA1431 | 6 |
| Competitive ability | copA | 4 |
| Competitive ability | met | 1 |
| Competitive ability | pts14C | 6 |
| Growth | treC | -- |
| Persistence | LJ1656 | -- |
| Persistence | msrB | 1 |
| Persistence | LJ1654 | 1 |
| Persistence | clpC | 2 |
5 Genome Instability
Bacterial genomes are plastic during evolutionary, due to horizontal gene transfer, genome rearrangement, and the activities of mobile DNA elements. Genomic islands, plasmid or other mobile elements, can play an important role in genome instability.
5.1 Genomic islands
| ID | Island start | Island end | contains resistance genes | contains Pathogenicity | contains Toxic metabolites | contains Probiotic properties |
| FM179323.1 | 528481 | 574816 | - | - | - | - |
| FM179323.1 | 540483 | 544870 | - | - | - | - |
| FM179323.1 | 1217555 | 1251630 | - | - | - | - |
| FM179323.1 | 1236375 | 1243268 | - | - | - | - |
| FM179323.1 | 1245193 | 1251630 | - | - | - | - |
| FM179323.1 | 1774364 | 1789081 | - | - | - | - |
| FM179323.1 | 1776555 | 1787082 | - | - | - | - |
| FM179323.1 | 2301647 | 2335435 | 1 | - | - | - |
| FM179323.1 | 2345557 | 2380958 | - | - | - | - |
| FM179323.1 | 2368993 | 2374987 | - | - | - | - |
| FM179323.1 | 2708654 | 2723994 | - | - | - | - |
| FM179323.1 | 2711621 | 2716386 | - | - | - | - |
5.2 Plasmids
| ID | Length | contains resistance genes | contains Pathogenicity | contains Toxic metabolites | contains Probiotic properties |
| FM179324.1 | 64508 | - | - | 1 | 2 |
5.3 Prophage
| Contig | REGION | REGION_LENGTH | COMPLETENESS(score) | TOTAL_PROTEIN_NUM | REGION_POSITION | GC_PERCENTAGE |
| FM179323.1 | 1 | 20.3Kb | questionable(70) | 16 | 697923-718231 | 44.68% |
| FM179324.1 | 2 | 10.1Kb | incomplete(50) | 10 | 29207-39386 | 43.60% |
5.4 Transposons
NO result found.5.5 CRISPR-Cas systems
| Sequence | Element | CRISPR Id / Cas Type | Start | End | Spacer / Gene | Repeat consensus / cas genes |
| FM179323 | CRISPR | FM179323_1 | 973331 | 973476 | 1 | GCGTGATGGCCGGTCTTTGGCCATTGCGCCCAAGGTCCTTACA |
6 Comparative genome in Lactobacillus Genomes
6.1 Tree of Lactobacillus Genomes
6.2 Antibiotic Resistance
Antibiotic Resistance Gene found in Lactobacillus Genomes,where "+" Present; "-" Absent;
| Class | Your Sequence | L.acidophilus_NCFM | L.acidophilus_La-14 | L.casei_BL23 | L.fermentum_CECT5716 | L.pentosus_SLC13 | L.reuteri_DSM20016 | L.rhamnosus.GG | L.rhamnosus.HN001 | L.rhamnosus.R0011 |
| fosfomycin | + | + | + | + | + | + | - | + | + | + |
| fluoroquinolone | + | + | + | + | + | + | + | + | + | + |
| daptomycin | + | - | - | + | - | + | + | + | + | + |
| tetracycline | - | - | - | - | - | + | - | - | - | + |
| glycopeptide | + | + | + | + | + | + | + | + | + | + |
| trimethoprim | - | - | - | + | - | - | + | - | - | - |
| streptogramin | + | + | + | + | + | - | + | + | + | + |
6.3 Pathogenicity
NO result found.
6.4 Probiotic properties
Probiotic properties found in Lactobacillus Genomes,where "+" Present; "-" Absent;
| Property | Your Sequence | Probiotic | |||||||||
| Properties | Your Sequence | L.acidophilus NCFM | L.acidophilus La-14 | L.casei BL23 | L.fermentum CECT5716 | L.pentosus SLC13 | L.reuteri DSM20016 | L.rhamnosus GG | L.rhamnosus HN001 | L.rhamnosus R0011 | |
| Anti-bacterial | + | + | + | + | + | + | + | + | + | + | |
| Anti-oxidant | + | + | + | + | + | + | + | + | + | + | |
| EPS | + | + | + | + | + | + | + | + | + | + | |
| Amico acid | Phenylalanine metabolism | + | - | - | + | - | - | - | + | + | + |
| Amico acid | Histidine metabolism | + | - | - | + | - | - | - | + | + | + |
| Amico acid | Arginine biosynthesis | + | + | + | + | + | + | + | + | + | + |
| Amico acid | Phenylalanine, tyrosine and tryptophan biosynthesis | + | - | - | + | - | - | - | + | + | + |
| Amico acid | Lysine biosynthesis | + | + | + | + | + | + | + | + | + | + |
| Amico acid | Alanine, aspartate and glutamate metabolism | + | + | + | + | + | + | + | + | + | + |
| Amico acid | Arginine and proline metabolism | + | + | + | + | + | + | + | + | + | + |
| Amico acid | Cysteine and methionine metabolism | + | + | + | + | + | + | + | + | + | + |
| Amico acid | Valine, leucine and isoleucine biosynthesis | + | + | + | + | + | + | + | + | + | + |
| Amico acid | Tryptophan metabolism | + | - | - | + | + | - | - | + | + | + |
| Amico acid | Tyrosine metabolism | + | + | + | + | + | + | + | + | + | + |
| Amico acid | Glycine, serine and threonine metabolism | + | + | + | + | + | + | + | + | + | + |
| Vitamin | Vitamin B6 metabolism | + | + | + | + | + | + | - | + | + | + |
| Vitamin | Folate biosynthesis | + | + | + | + | + | + | + | + | + | + |
| Vitamin | Thiamine metabolism | + | + | + | + | + | + | + | + | + | + |
| Vitamin | Riboflavin metabolism | + | + | + | + | - | + | + | + | + | + |
| Vitamin | Biotin metabolism | + | + | + | + | + | - | + | + | + | + |
| Vitamin | Nicotinate and nicotinamide metabolism | + | + | + | + | + | + | + | + | + | + |
| Vitamin | Lipoic acid metabolism | - | - | - | - | - | - | - | - | - | - |
| Vitamin | Retinol metabolism | - | - | - | + | - | - | - | - | - | - |
| Vitamin | Pantothenate and CoA biosynthesis | + | + | + | + | + | + | + | + | + | + |